Stem-loop sequence xtr-mir-99

AccessionMI0004821
DescriptionXenopus tropicalis miR-99 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ua     a         uc   u    u  ug  u 
5'   acaua acccguaga  cga cuug gg  aa u
     ||||| |||||||||  ||| |||| ||  ||  
3'   ugugu uggguaucu  gcu gaac uc  uu c
   ac     c         uu   c    -  gu  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173111.1: 668721-668791 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-99
xtr-mir-99GL173111.1: 668721-668791 [+]
xtr-let-7cGL173111.1: 669407-669500 [+]

Mature sequence xtr-miR-99

Accession MIMAT0003582
Sequence

8 - 

aacccguagauccgaucuugug

 - 29

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1