Stem-loop sequence xtr-mir-99

AccessionMI0004821 (change log)
DescriptionXenopus tropicalis miR-99 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ua     a         uc   u    u  ug  u 
5'   acaua acccguaga  cga cuug gg  aa u
     ||||| |||||||||  ||| |||| ||  ||  
3'   ugugu uggguaucu  gcu gaac uc  uu c
   ac     c         uu   c    -  gu  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 23121034-23121104 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-99
xtr-mir-99chr2: 23121034-23121104 [+]
xtr-let-7cchr2: 23121720-23121813 [+]
Database links

Mature sequence xtr-miR-99

Accession MIMAT0003582
Sequence

8 - 

aacccguagauccgaucuugug

 - 29

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1