Stem-loop sequence xtr-mir-106

AccessionMI0004822 (change log)
DescriptionXenopus tropicalis miR-106 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --    -a          a      g   aau 
5'   ugca  aagugcuuau gugcag uag   u
     ||||  |||||||||| |||||| |||   u
3'   acgu  uucacgaaua cacguc auc   a
   cu    cc          c      -   caa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47198219-47198281 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-106
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-106

Accession MIMAT0003583
Sequence

4 - 

aaaagugcuuauagugcagguaga

 - 27

Get sequence
Evidence by similarity; MI0000113
Predicted targets