Stem-loop sequence xtr-mir-107

AccessionMI0004823
DescriptionXenopus tropicalis miR-107 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu     --c    u  u           c   u   a 
5'   gcuuu   agcu cu uacaguguugc uug ggc u
     |||||   |||| || ||||||||||| ||| ||| g
3'   cgaaa   ucgg ga auguuacgacg aac uug g
   -a     cua    -  c           -   -   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172907.1: 146496-146568 [+]
sense
ENSXETT00000063684 ; PANK1-201; intron 5

Mature sequence xtr-miR-107

Accession MIMAT0003584
Sequence

46 - 

agcagcauuguacagggcuauca

 - 68

Get sequence
Evidence by similarity; MI0000114
Predicted targets