Stem-loop sequence xtr-mir-122

AccessionMI0004824
DescriptionXenopus tropicalis miR-122 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -g    augg       c           --u  c 
5'   agcu    aguguga aaugguguuug   gu a
     ||||    ||||||| |||||||||||   ||  
3'   ucga    ucacacu uuaccgcaaac   cg g
   ca    guaa       a           uau  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172864.1: 287748-287816 [+]
intergenic

Mature sequence xtr-miR-122

Accession MIMAT0003585
Sequence

7 - 

uggagugugacaaugguguuugu

 - 29

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1