Stem-loop sequence xtr-mir-122

AccessionMI0004824 (change log)
DescriptionXenopus tropicalis miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   -g    augg       c           --u  c 
5'   agcu    aguguga aaugguguuug   gu a
     ||||    ||||||| |||||||||||   ||  
3'   ucga    ucacacu uuaccgcaaac   cg g
   ca    guaa       a           uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 188440156-188440224 [-]
intergenic
Database links

Mature sequence xtr-miR-122

Accession MIMAT0003585
Sequence

7 - 

uggagugugacaaugguguuugu

 - 29

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1