Stem-loop sequence xtr-mir-125b-1

AccessionMI0004825
DescriptionXenopus tropicalis miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u    cc   u  -a    u    c           -  g    g 
5'  gcac  cuc ca  uccc gaga ccuaacuugug au uuua c
    ||||  ||| ||  |||| |||| ||||||||||| || ||||  
3'  cgug  gag gu  aggg uucu ggauugggcac ua aaau u
   -    uu   u  cg    -    c           c  a    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172760.1: 2528952-2529039 [+]
intergenic

Mature sequence xtr-miR-125b

Accession MIMAT0003586
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Evidence by similarity; MI0000470
Predicted targets