Stem-loop sequence xtr-mir-125b-2

AccessionMI0004826 (change log)
DescriptionXenopus tropicalis miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ga   uu     uc  ug   c            ggauuuu 
5'   cuu  ccuag  cc  aga ccuaacuuguga       u
     |||  |||||  ||  ||| ||||||||||||       u
3'   gag  ggauc  gg  ucu ggauugaacacu       a
   gg   gc     ca  gu   c            aacaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 23205565-23205649 [+]
intergenic
Database links

Mature sequence xtr-miR-125b

Accession MIMAT0003586
Sequence

13 - 

ucccugagacccuaacuuguga

 - 34

Get sequence
Evidence by similarity; MI0000470
Predicted targets