Stem-loop sequence xtr-mir-125b-2

AccessionMI0004826
DescriptionXenopus tropicalis miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ga   uu     uc  ug   c            ggauuuu 
5'   cuu  ccuag  cc  aga ccuaacuuguga       u
     |||  |||||  ||  ||| ||||||||||||       u
3'   gag  ggauc  gg  ucu ggauugaacacu       a
   gg   gc     ca  gu   c            aacaacg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173111.1: 749841-749925 [+]
intergenic

Mature sequence xtr-miR-125b

Accession MIMAT0003586
Sequence

13 - 

ucccugagacccuaacuuguga

 - 34

Get sequence
Evidence by similarity; MI0000470
Predicted targets