Stem-loop sequence xtr-mir-126

AccessionMI0004827
DescriptionXenopus tropicalis miR-126 stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gg                u       c cug  uc 
5'   cugugcauuauuacuu ugguacg g   ug  a
     |||||||||||||||| ||||||| |   ||   
3'   gacgcguaauaaugag gccaugc c   ac  c
   --                u       u -aa  ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172773.1: 1684934-1685002 [-]
sense
ENSXETT00000001685 ; egfl7-201; intron 7

Mature sequence xtr-miR-126-5p

Accession MIMAT0003587
Previous IDsxtr-miR-126*
Sequence

8 - 

cauuauuacuuuugguacgcg

 - 28

Get sequence
Evidence by similarity; MI0000153

Mature sequence xtr-miR-126-3p

Accession MIMAT0003588
Previous IDsxtr-miR-126
Sequence

45 - 

ucguaccgugaguaauaaugc

 - 65

Get sequence
Evidence by similarity; MI0000153
Predicted targets