Stem-loop sequence xtr-mir-128-2

AccessionMI0004828
DescriptionXenopus tropicalis miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   gu    cu    c        uua      aa    g gag 
5'   gcag  ggaa gggggccg   cacugu  gaga u   u
     ||||  |||| ||||||||   ||||||  |||| |    
3'   uguc  ucuu ucucuggc   gugaca  cucu g   a
   --    au    u        caa      --    g aug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173401.1: 415153-415232 [+]
intergenic

Mature sequence xtr-miR-128

Accession MIMAT0003589
Sequence

51 - 

ucacagugaaccggucucuuuu

 - 72

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1