Stem-loop sequence xtr-mir-129-1

AccessionMI0004829 (change log)
DescriptionXenopus tropicalis miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   -       u     -       c   cu      g   ua  uaa 
5'  guccuuc caaau cuuuuug ggu  gggcuu cug  ug   a
    ||||||| ||||| ||||||| |||  |||||| |||  ||    
3'  cgggagg guuua gaaaaac cca  cccgaa ggc  au   u
   g       c     c       c   uu      g   cg  cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 3080976-3081065 [+]
intergenic
Database links

Mature sequence xtr-miR-129

Accession MIMAT0003590
Sequence

14 - 

cuuuuugcggucugggcuugc

 - 34

Get sequence
Evidence by similarity; MI0001983
Predicted targets