Stem-loop sequence xtr-mir-129-2

AccessionMI0004830 (change log)
DescriptionXenopus tropicalis miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Literature search

1 open access papers mention xtr-mir-129-2
(4 sentences)

Stem-loop
   --  u    -g       c  -ucu      g   --uu  ca 
5'   uc caaa  cuuuuug gg    gggcuu cug    cu  a
     || ||||  ||||||| ||    |||||| |||    ||  u
3'   ag guuu  gaaaaac cc    cccgaa gac    ga  c
   gg  c    aa       -  uauu      g   cuau  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 78292717-78292798 [-]
intergenic
Database links

Mature sequence xtr-miR-129

Accession MIMAT0003590
Sequence

9 - 

cuuuuugcggucugggcuugc

 - 29

Get sequence
Evidence by similarity; MI0001983
Predicted targets