Stem-loop sequence xtr-mir-129-2

AccessionMI0004830
DescriptionXenopus tropicalis miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --  u    -g       c  -ucu      g   --uu  ca 
5'   uc caaa  cuuuuug gg    gggcuu cug    cu  a
     || ||||  ||||||| ||    |||||| |||    ||  u
3'   ag guuu  gaaaaac cc    cccgaa gac    ga  c
   gg  c    aa       -  uauu      g   cuau  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172647.1: 151236-151317 [+]
intergenic

Mature sequence xtr-miR-129

Accession MIMAT0003590
Sequence

9 - 

cuuuuugcggucugggcuugc

 - 29

Get sequence
Evidence by similarity; MI0001983
Predicted targets