Stem-loop sequence xtr-mir-130a

AccessionMI0004831
DescriptionXenopus tropicalis miR-130a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --   u             u          a  -----a   gu 
5'   cug ccagugcccuuuu auguuguacu cu      gug  c
     ||| ||||||||||||| |||||||||| ||      |||   
3'   gac gguuacgggaaaa uguaacguga ga      cac  a
   gg   c             u          c  aaaaaa   ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172728.1: 2370211-2370293 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-130a
xtr-mir-130aGL172728.1: 2370211-2370293 [-]
xtr-mir-301-1GL172728.1: 2370001-2370084 [-]

Mature sequence xtr-miR-130a

Accession MIMAT0003591
Sequence

53 - 

cagugcaauguuaaaagggcau

 - 74

Get sequence
Evidence by similarity; MI0001984
Predicted targets