Stem-loop sequence xtr-mir-130a

AccessionMI0004831 (change log)
DescriptionXenopus tropicalis miR-130a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   --   u             u          a  -----a   gu 
5'   cug ccagugcccuuuu auguuguacu cu      gug  c
     ||| ||||||||||||| |||||||||| ||      |||   
3'   gac gguuacgggaaaa uguaacguga ga      cac  a
   gg   c             u          c  aaaaaa   ac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 91417440-91417522 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-130a
xtr-mir-130achr2: 91417440-91417522 [+]
xtr-mir-301-1chr2: 91417649-91417732 [+]
Database links

Mature sequence xtr-miR-130a

Accession MIMAT0003591
Sequence

53 - 

cagugcaauguuaaaagggcau

 - 74

Get sequence
Evidence by similarity; MI0001984
Predicted targets