Stem-loop sequence xtr-mir-130c

AccessionMI0004832
DescriptionXenopus tropicalis miR-130c stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   au   ug        uc         a    aau 
5'   ccg  gcccuuuu  uguuguacu cugg   u
     |||  ||||||||  ||||||||| ||||   u
3'   ggu  cgggaaaa  auaacguga gauu   g
   uc   ua        uu         c    aau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172648.1: 3568249-3568319 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-130c
xtr-mir-130cGL172648.1: 3568249-3568319 [+]
xtr-mir-301-2GL172648.1: 3569092-3569164 [+]
xtr-mir-130bGL172648.1: 3575983-3576058 [+]

Mature sequence xtr-miR-130c

Accession MIMAT0003592
Sequence

45 - 

cagugcaauauuaaaagggcau

 - 66

Get sequence
Evidence by similarity; MI0001987
Predicted targets