Stem-loop sequence xtr-mir-132

AccessionMI0004834 (change log)
DescriptionXenopus tropicalis miR-132 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   cu    --  a    a         u            ---   g 
5'   gucu  cc gggc accguggcu uagauuguuacu   gua u
     ||||  || |||| ||||||||| ||||||||||||   |||  
3'   uaga  gg cucg ugguaccga aucugacaaugg   cgu u
   cg    ac  g    c         c            uua   c 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 27663361-27663447 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-132
xtr-mir-212chr2: 27657630-27657725 [+]
xtr-mir-132chr2: 27663361-27663447 [+]
Database links

Mature sequence xtr-miR-132

Accession MIMAT0003594
Sequence

52 - 

uaacagucuacagccauggucg

 - 73

Get sequence
Evidence by similarity; MI0001991
Predicted targets