Stem-loop sequence xtr-mir-132

AccessionMI0004834
DescriptionXenopus tropicalis miR-132 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu    --  a    a         u            ---   g 
5'   gucu  cc gggc accguggcu uagauuguuacu   gua u
     ||||  || |||| ||||||||| ||||||||||||   |||  
3'   uaga  gg cucg ugguaccga aucugacaaugg   cgu u
   cg    ac  g    c         c            uua   c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172903.1: 945048-945134 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-132
xtr-mir-212GL172903.1: 950770-950865 [-]
xtr-mir-132GL172903.1: 945048-945134 [-]

Mature sequence xtr-miR-132

Accession MIMAT0003594
Sequence

52 - 

uaacagucuacagccauggucg

 - 73

Get sequence
Evidence by similarity; MI0001991
Predicted targets