Stem-loop sequence xtr-mir-133c

AccessionMI0004835 (change log)
DescriptionXenopus tropicalis miR-133c stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention xtr-mir-133c
(2 sentences)

Stem-loop
   --     uuu   aa       aa  u  a        aacug 
5'   aaugc   gcu  agcuggu  aa gg accaaauc     u
     |||||   |||  |||||||  || || ||||||||      
3'   uuacg   cga  ucgacca  uu cc ugguuuag     u
   ag     ugu   cg       ac  c  c        guaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460667.1: 81387-81472 [-]
intergenic
Database links

Mature sequence xtr-miR-133c

Accession MIMAT0003595
Sequence

52 - 

uugguccccuucaaccagcugc

 - 73

Get sequence
Evidence by similarity; MI0001992
Predicted targets