Stem-loop sequence xtr-mir-133b

AccessionMI0004837 (change log)
DescriptionXenopus tropicalis miR-133b stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --    u         ca  c  a      u  g   u 
5'   cugc auggcuggu  aa gg accaag cc ucu c
     |||| |||||||||  || || |||||| || ||| c
3'   gacg uaucgacca  uu cc ugguuu gg aga u
   au    u         ac  c  c      -  -   u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460357.1: 1078318-1078392 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-133b
xtr-mir-206KV460357.1: 1079506-1079575 [-]
xtr-mir-133bKV460357.1: 1078318-1078392 [-]
Database links

Mature sequence xtr-miR-133b

Accession MIMAT0003597
Sequence

47 - 

uugguccccuucaaccagcua

 - 67

Get sequence
Evidence by similarity; MI0000821
Predicted targets