Stem-loop sequence xtr-mir-135-1

AccessionMI0004838
DescriptionXenopus tropicalis miR-135-1 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   aaa     ugug                u            -ua  a 
5'  gau   uucac    guguuuuauggcuuuu auuccuauguga   gu a
    |||   |||||    |||||||||||||||| ||||||||||||   ||  
3'  cug   aagug    cauaaaguaccgaagg uagggauguacu   ua u
   a   -aa     -uua                -            cug  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172641.1: 468532-468631 [+]
intergenic

Mature sequence xtr-miR-135

Accession MIMAT0003598
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Evidence by similarity; MI0000645
Predicted targets