Stem-loop sequence xtr-mir-135-1

AccessionMI0004838 (change log)
DescriptionXenopus tropicalis miR-135-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   a   aaa     ugug                u            -ua  a 
5'  gau   uucac    guguuuuauggcuuuu auuccuauguga   gu a
    |||   |||||    |||||||||||||||| ||||||||||||   ||  
3'  cug   aagug    cauaaaguaccgaagg uagggauguacu   ua u
   a   -aa     -uua                -            cug  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 41571695-41571794 [+]
intergenic
Database links

Mature sequence xtr-miR-135

Accession MIMAT0003598
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Evidence by similarity; MI0000645
Predicted targets