Stem-loop sequence xtr-mir-140

AccessionMI0004841
DescriptionXenopus tropicalis miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
   cc             -c  a             a       uu   uc 
5'   cucucuguguccu  cc gugguuuuacccu ugguagg  acg  a
     |||||||||||||  || ||||||||||||| |||||||  |||   
3'   gaggggcauagga  gg caccaagauggga accaucu  ugu  g
   uc             ca  -             c       --   cg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172939.1: 222731-222824 [+]
sense
ENSXETT00000038759 ; wwp2-201; intron 14
ENSXETT00000050030 ; wwp2-202; intron 15

Mature sequence xtr-miR-140

Accession MIMAT0003601
Sequence

19 - 

agugguuuuacccuaugguag

 - 39

Get sequence
Evidence by similarity; MI0000456
Predicted targets