Stem-loop sequence xtr-mir-142-1

AccessionMI0004842 (change log)
DescriptionXenopus tropicalis miR-142-1 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   --       gc  c           a         u  aca ga 
5'   cagugca  ca ccauaaaguag aagcacuac ag   g  c
     |||||||  || ||||||||||| ||||||||| ||   |  u
3'   gucaugu  gu gguauuucauc uuugugaug uc   c  g
   gg       ga  a           c         -  --g aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 38445580-38445665 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-142-1
xtr-mir-142-1chr2: 38445580-38445665 [+]
xtr-mir-142-2chr2: 38446762-38446847 [+]
Database links

Mature sequence xtr-miR-142-5p

Accession MIMAT0003602
Sequence

14 - 

cauaaaguagaaagcacuac

 - 33

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-142-3p

Accession MIMAT0003603
Sequence

51 - 

uguaguguuuccuacuuuaugga

 - 73

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1