Stem-loop sequence xtr-mir-142-2

AccessionMI0004843
DescriptionXenopus tropicalis miR-142-2 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   --       gc  c           a         u  aca ga 
5'   cagugca  ca ccauaaaguag aagcacuac ag   g  c
     |||||||  || ||||||||||| ||||||||| ||   |  u
3'   gucaugu  gu gguauuucauc uuugugaug uc   c  g
   gg       ga  a           c         -  --g aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172771.1: 981268-981353 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-142-2
xtr-mir-142-2GL172771.1: 981268-981353 [-]
xtr-mir-142-1GL172771.1: 980086-980171 [-]

Mature sequence xtr-miR-142-5p

Accession MIMAT0003602
Sequence

14 - 

cauaaaguagaaagcacuac

 - 33

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-142-3p

Accession MIMAT0003603
Sequence

51 - 

uguaguguuuccuacuuuaugga

 - 73

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1