Stem-loop sequence xtr-mir-146a

AccessionMI0004844
Previous IDsxtr-mir-146
DescriptionXenopus tropicalis miR-146 stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --  a  a u   u    u  a       auu         guua 
5'   ca ug g ucu agcu ug gaacuga   ccauagguu    g
     || || | ||| |||| || |||||||   |||||||||    a
3'   gu ac c agg ucga ac cuugauu   gguauccag    g
   cg  c  c u   u    u  -       cgu         auug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL176600.1: 4737-4826 [-]
intergenic

Mature sequence xtr-miR-146a

Accession MIMAT0003604
Previous IDsxtr-miR-146
Sequence

18 - 

ugagaacugaauuccauagguu

 - 39

Get sequence
Evidence by similarity; MI0000477
Predicted targets