Stem-loop sequence xtr-mir-146a

AccessionMI0004844 (change log)
Previous IDsxtr-mir-146
DescriptionXenopus tropicalis miR-146 stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   --  a  a u   u    u  a       auu         guua 
5'   ca ug g ucu agcu ug gaacuga   ccauagguu    g
     || || | ||| |||| || |||||||   |||||||||    a
3'   gu ac c agg ucga ac cuugauu   gguauccag    g
   cg  c  c u   u    u  -       cgu         auug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 14163615-14163704 [+]
intergenic
Database links

Mature sequence xtr-miR-146a

Accession MIMAT0003604
Previous IDsxtr-miR-146
Sequence

18 - 

ugagaacugaauuccauagguu

 - 39

Get sequence
Evidence by similarity; MI0000477
Predicted targets