Stem-loop sequence xtr-mir-148b

AccessionMI0004845
DescriptionXenopus tropicalis miR-148b stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ug  -  ac   g       ug         u  a    cc    gugag 
5'   ag ga  agc uuugagg  aaguucugu au cacu  ggcu     u
     || ||  ||| |||||||  ||||||||| || ||||  ||||     a
3'   uc cu  ucg gagcucu  uucaagaca ua guga  cuga     a
   -a  a  --   g       gu         c  c    --    aggug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172797.1: 1950088-1950184 [-]
sense
ENSXETT00000057162 ; copz1-201; intron 1
ENSXETT00000057161 ; copz1-202; intron 1

Mature sequence xtr-miR-148b

Accession MIMAT0003605
Sequence

60 - 

ucagugcaucacagaacuuugu

 - 81

Get sequence
Evidence by similarity; MI0000616
Predicted targets