Stem-loop sequence xtr-mir-148b

AccessionMI0004845 (change log)
DescriptionXenopus tropicalis miR-148b stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   ug  -  ac   g       ug         u  a    cc    gugag 
5'   ag ga  agc uuugagg  aaguucugu au cacu  ggcu     u
     || ||  ||| |||||||  ||||||||| || ||||  ||||     a
3'   uc cu  ucg gagcucu  uucaagaca ua guga  cuga     a
   -a  a  --   g       gu         c  c    --    aggug 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 142379057-142379153 [-]
sense
ENSXETT00000057162 ; copz1-201; intron 1
ENSXETT00000057161 ; copz1-202; intron 1
Database links

Mature sequence xtr-miR-148b

Accession MIMAT0003605
Sequence

60 - 

ucagugcaucacagaacuuugu

 - 81

Get sequence
Evidence by similarity; MI0000616
Predicted targets