Stem-loop sequence xtr-mir-150

AccessionMI0004846
DescriptionXenopus tropicalis miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --  c  uc   a  c            gaua 
5'   cu uc  cca cc uuguaccagagu    a
     || ||  ||| || ||||||||||||     
3'   ga ag  ggu gg gacauggucuca    u
   ag  a  uc   a  a            aggg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173018.1: 958342-958405 [-]
intergenic

Mature sequence xtr-miR-150

Accession MIMAT0003606
Sequence

4 - 

ucucccaacccuuguaccagag

 - 25

Get sequence
Evidence by similarity; MI0000920
Predicted targets