Stem-loop sequence xtr-mir-153-1

AccessionMI0004847
DescriptionXenopus tropicalis miR-153-1 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   ca  g      u  -              -       u ua  u 
5'   cg cugccc ug ucauuuuugugauu ugcagcu g  au u
     || |||||| || |||||||||||||| ||||||| |  ||  
3'   gu gacggg ac agugaaaacacuga acguuga c  ug u
   gg  g      u  u              u       - uc  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172713.1: 2808049-2808135 [+]
sense
ENSXETT00000041784 ; ptprn-201; intron 21

Mature sequence xtr-miR-153

Accession MIMAT0003607
Sequence

53 - 

uugcauagucacaaaaguga

 - 72

Get sequence
Evidence by similarity; MI0002021
Predicted targets