Stem-loop sequence xtr-mir-155

AccessionMI0004848
DescriptionXenopus tropicalis miR-155 stem-loop
Gene family MIPF0000157; mir-155
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-155. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MiR-155 is a microRNA that in humans is encoded by the MIR155 host gene or MIR155HG. MiR-155 plays an important role in various physiological and pathological processes. Exogenous molecular control in vivo of miR-155 expression may inhibit malignant growth, viral infections, and attenuate the progression of cardiovascular diseases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----uau         u    a        uu uaa 
5'         uaaugcuaa cgug uagggguu  u   u
           ||||||||| |||| ||||||||  |    
3'         auuacgauu guac auccucag  a   a
   guacuauu         -    -        uu uac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172800.1: 663493-663561 [+]
intergenic

Mature sequence xtr-miR-155

Accession MIMAT0003608
Sequence

3 - 

uuaaugcuaaucgugauagggg

 - 24

Get sequence
Evidence by similarity; MI0000681
Predicted targets