Stem-loop sequence xtr-mir-181b-1

AccessionMI0004849
DescriptionXenopus tropicalis miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aa  u    aucaa         cug          -ga  u 
5'   gg caca     cauucauug   ucgguggguu   gu a
     || ||||     |||||||||   ||||||||||   || a
3'   cc gugu     guaaguagc   agucgcucga   ca g
   cc  u    -caac         --a          aca  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172655.1: 4185876-4185958 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181b-1
xtr-mir-181a-1GL172655.1: 4185417-4185506 [+]
xtr-mir-181b-1GL172655.1: 4185876-4185958 [+]

Mature sequence xtr-miR-181b

Accession MIMAT0003609
Sequence

13 - 

aacauucauugcugucgguggg

 - 34

Get sequence
Evidence by similarity; MI0000683
Predicted targets