Stem-loop sequence xtr-mir-181b-1

AccessionMI0004849 (change log)
DescriptionXenopus tropicalis miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   aa  u    aucaa         cug          -ga  u 
5'   gg caca     cauucauug   ucgguggguu   gu a
     || ||||     |||||||||   ||||||||||   || a
3'   cc gugu     guaaguagc   agucgcucga   ca g
   cc  u    -caac         --a          aca  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 101423391-101423473 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181b-1
xtr-mir-181a-1chr4: 101423843-101423932 [-]
xtr-mir-181b-1chr4: 101423391-101423473 [-]
Database links

Mature sequence xtr-miR-181b

Accession MIMAT0003609
Sequence

13 - 

aacauucauugcugucgguggg

 - 34

Get sequence
Evidence by similarity; MI0000683
Predicted targets