Stem-loop sequence xtr-mir-181b-2

AccessionMI0004850 (change log)
DescriptionXenopus tropicalis miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   aa   -     auaaa         cu           guagu 
5'   ugg cugca     cauucauug  gucgguggguu     u
     ||| |||||     |||||||||  |||||||||||      
3'   acc gacgu     guaaguaac  uaguuacucga     u
   --   a     caaac         --           aaaga 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460364.1: 1381322-1381404 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181b-2
xtr-mir-181a-2KV460364.1: 1377155-1377249 [+]
xtr-mir-181b-2KV460364.1: 1381322-1381404 [+]
Database links

Mature sequence xtr-miR-181b

Accession MIMAT0003609
Sequence

14 - 

aacauucauugcugucgguggg

 - 35

Get sequence
Evidence by similarity; MI0000683
Predicted targets