Stem-loop sequence xtr-mir-182

AccessionMI0004851
DescriptionXenopus tropicalis miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   a  g   ----    u   a   u       u -g      uca      ugag  a 
5'  gu gcu    ucuc ggc gug uuggcaa g  uagaac   cacugg    cu u
    || |||    |||| ||| ||| ||||||| |  ||||||   ||||||    ||  
3'  cg cga    aggg ccg uau aaccguu c  aucuug   guggcc    ga g
   a  a   aaua    u   g   c       - ag      ---      --ua  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172647.1: 1012293-1012397 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-182
xtr-mir-183GL172647.1: 1016139-1016235 [-]
xtr-mir-96GL172647.1: 1014994-1015068 [-]
xtr-mir-182GL172647.1: 1012293-1012397 [-]

Mature sequence xtr-miR-182-5p

Accession MIMAT0003610
Previous IDsxtr-miR-182
Sequence

20 - 

uuuggcaaugguagaacucaca

 - 41

Get sequence
Evidence by similarity; MI0001368
Predicted targets

Mature sequence xtr-miR-182-3p

Accession MIMAT0003611
Previous IDsxtr-miR-182*
Sequence

64 - 

ugguucuagacuugccaacua

 - 84

Get sequence
Evidence by similarity; MI0001368