Stem-loop sequence xtr-mir-183

AccessionMI0004852
DescriptionXenopus tropicalis miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   ca  cc  -         g      --ac     ga        ugaaaa 
5'   uc  uc cuguucugu uauggc    uggua  auucacug      c
     ||  || ||||||||| ||||||    |||||  ||||||||       
3'   ag  ag gacgagaca auaccg    accau  uaagugac      a
   ca  aa  a         a      ggau     --        uaaaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172647.1: 1016139-1016235 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-183
xtr-mir-183GL172647.1: 1016139-1016235 [-]
xtr-mir-96GL172647.1: 1014994-1015068 [-]
xtr-mir-182GL172647.1: 1012293-1012397 [-]

Mature sequence xtr-miR-183

Accession MIMAT0003612
Sequence

19 - 

uauggcacugguagaauucacug

 - 41

Get sequence
Evidence by similarity; MI0001369
Predicted targets