Stem-loop sequence xtr-mir-184

AccessionMI0004853
DescriptionXenopus tropicalis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c    au   uu        c      a c     uuuuca 
5'  cagu  cac  ccuuauca uuuucc g ccagc      u
    ||||  |||  |||||||| |||||| | |||||      g
3'  guca  gug  ggaauagu aagagg c gguug      a
   -    gu   uc        c      - a     ucaaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172676.1: 1017907-1017989 [+]
intergenic

Mature sequence xtr-miR-184

Accession MIMAT0003613
Sequence

53 - 

uggacggagaacugauaaggcu

 - 74

Get sequence
Evidence by similarity; MI0002026
Predicted targets