Stem-loop sequence xtr-mir-184

AccessionMI0004853 (change log)
DescriptionXenopus tropicalis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   c    au   uu        c      a c     uuuuca 
5'  cagu  cac  ccuuauca uuuucc g ccagc      u
    ||||  |||  |||||||| |||||| | |||||      g
3'  guca  gug  ggaauagu aagagg c gguug      a
   -    gu   uc        c      - a     ucaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 115714268-115714350 [-]
intergenic
Database links

Mature sequence xtr-miR-184

Accession MIMAT0003613
Sequence

53 - 

uggacggagaacugauaaggcu

 - 74

Get sequence
Evidence by similarity; MI0002026
Predicted targets