Stem-loop sequence xtr-mir-187

AccessionMI0004854
DescriptionXenopus tropicalis miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   --    a    u      a             --   ag  u 
5'   uggu uacc uugguu caacacaggacau  ggg  cu a
     |||| |||| |||||| |||||||||||||  |||  || c
3'   accg gugg gaccga guuguguucugug  ccc  gg u
   aa    -    u      c             cu   aa  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173392.1: 303898-303979 [+]
intergenic

Mature sequence xtr-miR-187

Accession MIMAT0003614
Sequence

50 - 

ucgugucuuguguugcagcca

 - 70

Get sequence
Evidence by similarity; MI0001370
Predicted targets