Stem-loop sequence xtr-mir-192

AccessionMI0004855 (change log)
DescriptionXenopus tropicalis miR-192 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   ga   u        a  a     -          cca ug   g 
5'   gug acgggccu ug ccuau gaauugacag   g  gau u
     ||| |||||||| || ||||| ||||||||||   |  ||| g
3'   cac ugcuugga ac ggaug cuuaacuguc   c  cug a
   uc   c        c  c     u          --- gu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 38493641-38493727 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-192
xtr-mir-194-2chr4: 38492064-38492149 [+]
xtr-mir-192chr4: 38493641-38493727 [+]
Database links

Mature sequence xtr-miR-192

Accession MIMAT0003615
Sequence

15 - 

augaccuaugaauugacagcc

 - 35

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1