Stem-loop sequence xtr-mir-192

AccessionMI0004855
DescriptionXenopus tropicalis miR-192 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ga   u        a  a     -          cca ug   g 
5'   gug acgggccu ug ccuau gaauugacag   g  gau u
     ||| |||||||| || ||||| ||||||||||   |  ||| g
3'   cac ugcuugga ac ggaug cuuaacuguc   c  cug a
   uc   c        c  c     u          --- gu   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172932.1: 1453300-1453386 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-192
xtr-mir-194-2GL172932.1: 1451723-1451808 [+]
xtr-mir-192GL172932.1: 1453300-1453386 [+]

Mature sequence xtr-miR-192

Accession MIMAT0003615
Sequence

15 - 

augaccuaugaauugacagcc

 - 35

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1