Stem-loop sequence xtr-mir-193

AccessionMI0004856
DescriptionXenopus tropicalis miR-193 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   g   -        u          g    g  a  a c   u 
5'  ugg uuucggag cgggauuuug gggc ag ug g uaa g
    ||| |||||||| |||||||||| |||| || || | |||  
3'  acu aaggucuu gcccugaaac cccg uc ac c auu a
   -   g        c          g    g  a  - u   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172788.1: 275891-275973 [+]
intergenic

Mature sequence xtr-miR-193

Accession MIMAT0003616
Sequence

51 - 

aacuggcccgcaaagucccgcuuc

 - 74

Get sequence
Evidence by similarity; MI0002032
Predicted targets