Stem-loop sequence xtr-mir-194-1

AccessionMI0004857 (change log)
DescriptionXenopus tropicalis miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   ua    g       u         a      g    cuug 
5'   gugu uaucagg guaacagca cuccau ugga    u
     |||| ||||||| ||||||||| |||||| ||||    c
3'   cacg guaguuu cauugucgu gaggug accu    c
   --    g       u         a      -    uaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 6915454-6915533 [+]
antisense
ENSXETT00000064574 ; iars2-202; intron 12
ENSXETT00000005915 ; iars2-201; intron 12
Clustered miRNAs
< 10kb from xtr-mir-194-1
xtr-mir-194-1chr5: 6915454-6915533 [+]
xtr-mir-215chr5: 6916154-6916250 [+]
Database links

Mature sequence xtr-miR-194

Accession MIMAT0003617
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1