Stem-loop sequence xtr-mir-194-2

AccessionMI0004858
DescriptionXenopus tropicalis miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -u     u   a  cu         a      g     --g  g 
5'   gaugc cau ac  guaacagca cuccau uggaa   ua a
     ||||| ||| ||  ||||||||| |||||| |||||   ||  
3'   cuaug gua ug  uauugucgu gaggug gccuu   au u
   au     u   a  uc         a      -     aua  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172932.1: 1451723-1451808 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-194-2
xtr-mir-194-2GL172932.1: 1451723-1451808 [+]
xtr-mir-192GL172932.1: 1453300-1453386 [+]

Mature sequence xtr-miR-194

Accession MIMAT0003617
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1