Stem-loop sequence xtr-mir-194-2

AccessionMI0004858 (change log)
DescriptionXenopus tropicalis miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   -u     u   a  cu         a      g     --g  g 
5'   gaugc cau ac  guaacagca cuccau uggaa   ua a
     ||||| ||| ||  ||||||||| |||||| |||||   ||  
3'   cuaug gua ug  uauugucgu gaggug gccuu   au u
   au     u   a  uc         a      -     aua  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 38492064-38492149 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-194-2
xtr-mir-194-2chr4: 38492064-38492149 [+]
xtr-mir-192chr4: 38493641-38493727 [+]
Database links

Mature sequence xtr-miR-194

Accession MIMAT0003617
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1