Stem-loop sequence xtr-mir-199a

AccessionMI0004859 (change log)
DescriptionXenopus tropicalis miR-199a stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   aa aa  -     c   gcc       u        c   ---u   ga 
5'   g  cc ugcuc guc   ccagugu cagacuac ugu    cag  c
     |  || ||||| |||   ||||||| |||||||| |||    |||  a
3'   c  gg acggg cag   gguuaca gucugaug aca    guc  a
   ga ag  u     u   auu       c        -   uguu   gu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 97341496-97341591 [+]
antisense
ENSXETT00000001173 ; dnm3-201; intron 18
Clustered miRNAs
< 10kb from xtr-mir-199a
xtr-mir-199achr4: 97341496-97341591 [+]
xtr-mir-214chr4: 97346601-97346707 [+]
Database links

Mature sequence xtr-miR-199a-5p

Accession MIMAT0003618
Previous IDsxtr-miR-199a
Sequence

19 - 

cccaguguucagacuaccuguuc

 - 41

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-199a-3p

Accession MIMAT0003619
Previous IDsxtr-miR-199a*
Sequence

57 - 

uacaguagucugcacauugguu

 - 78

Get sequence
Evidence by similarity; MI0000281
Predicted targets

References

1