Stem-loop sequence xtr-mir-199a

AccessionMI0004859
DescriptionXenopus tropicalis miR-199a stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aa aa  -     c   gcc       u        c   ---u   ga 
5'   g  cc ugcuc guc   ccagugu cagacuac ugu    cag  c
     |  || ||||| |||   ||||||| |||||||| |||    |||  a
3'   c  gg acggg cag   gguuaca gucugaug aca    guc  a
   ga ag  u     u   auu       c        -   uguu   gu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172721.1: 1809312-1809407 [-]
antisense
ENSXETT00000001173 ; dnm3-201; intron 18
Clustered miRNAs
< 10kb from xtr-mir-199a
xtr-mir-199aGL172721.1: 1809312-1809407 [-]
xtr-mir-214GL172721.1: 1804189-1804295 [-]

Mature sequence xtr-miR-199a-5p

Accession MIMAT0003618
Previous IDsxtr-miR-199a
Sequence

19 - 

cccaguguucagacuaccuguuc

 - 41

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-199a-3p

Accession MIMAT0003619
Previous IDsxtr-miR-199a*
Sequence

57 - 

uacaguagucugcacauugguu

 - 78

Get sequence
Evidence by similarity; MI0000281

References

1