Stem-loop sequence xtr-mir-202-1

AccessionMI0004860
DescriptionXenopus tropicalis miR-202-1 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop
   --   -     u  u           -a   a        aaaa 
5'   cuc gcugu cc uuuuccuaugc  uau ccucuuug    a
     ||| ||||| || |||||||||||  ||| ||||||||    u
3'   gag cgacg gg aaaaggguacg  aua ggggaaau    g
   cc   u     c  u           gg   c        guaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172902.1: 963484-963570 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-202-1
xtr-mir-202-2GL172902.1: 971211-971297 [-]
xtr-mir-202-1GL172902.1: 963484-963570 [-]

Mature sequence xtr-miR-202-5p

Accession MIMAT0003620
Previous IDsxtr-miR-202*
Sequence

14 - 

uuuccuaugcauauaccucuuu

 - 35

Get sequence
Evidence by similarity; MI0002040

Mature sequence xtr-miR-202-3p

Accession MIMAT0003621
Previous IDsxtr-miR-202
Sequence

51 - 

aggggcauagggcaugggaaaa

 - 72

Get sequence
Evidence by similarity; MI0002040
Predicted targets