Stem-loop sequence xtr-mir-205b

AccessionMI0004862
DescriptionXenopus tropicalis miR-205b stem-loop
Gene family MIPF0000058; mir-205
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that -- by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2-- Mir-205 is involved in epithelial to mesenchymal transition (EMT) and tumor invasion[citation needed]. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. The cause of miR-200 silencing in naturally-occurring cancer cells, however, remains largely unknown.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ug   c  uc      u    -c   uc   ug aa 
5'   cug ug  cuucau ccac  gga  cug  u  a
     ||| ||  |||||| ||||  |||  |||  |  u
3'   gau ac  gaagua ggug  ccu  gac  a  a
   --   u  gu      c    ac   ua   cu au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172680.1: 2303110-2303181 [+]
sense
ENSXETT00000035280 ; otol1-201; intron 31

Mature sequence xtr-miR-205b

Accession MIMAT0003622
Sequence

9 - 

uccuucauuccaccggauccug

 - 30

Get sequence
Evidence by similarity; MI0001378
Predicted targets