Stem-loop sequence xtr-mir-205b

AccessionMI0004862 (change log)
DescriptionXenopus tropicalis miR-205b stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   ug   c  uc      u    -c   uc   ug aa 
5'   cug ug  cuucau ccac  gga  cug  u  a
     ||| ||  |||||| ||||  |||  |||  |  u
3'   gau ac  gaagua ggug  ccu  gac  a  a
   --   u  gu      c    ac   ua   cu au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 125249612-125249683 [-]
sense
ENSXETT00000035280 ; otol1-201; intron 31
Database links

Mature sequence xtr-miR-205b

Accession MIMAT0003622
Sequence

9 - 

uccuucauuccaccggauccug

 - 30

Get sequence
Evidence by similarity; MI0001378
Predicted targets