Stem-loop sequence xtr-mir-206

AccessionMI0004863 (change log)
DescriptionXenopus tropicalis miR-206 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
                         ac     uga  ua 
5' gaggucacaugcuucuuuauau  ccaua   ac  c
   ||||||||||||||||||||||  |||||   ||   
3' cuucggugugugaaggaaugua  gguau   ug  a
                         -a     ---  uu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460357.1: 1079506-1079575 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-206
xtr-mir-206KV460357.1: 1079506-1079575 [-]
xtr-mir-133bKV460357.1: 1078318-1078392 [-]
Database links

Mature sequence xtr-miR-206

Accession MIMAT0003623
Sequence

45 - 

uggaauguaaggaagugugugg

 - 66

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1