Stem-loop sequence xtr-mir-210

AccessionMI0004864
DescriptionXenopus tropicalis miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   -      a   c    a   acua       u  c  ugcuc 
5'  ucc agaugc ggu agcc cug    acgcaca ug gc     c
    ||| |||||| ||| |||| |||    ||||||| || ||      
3'  agg ucuacg cca ucgg gac    ugcgugu ac cg     u
   a   a      a   a    c   agug       c  -  uaaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173034.1: 268957-269047 [+]
intergenic

Mature sequence xtr-miR-210

Accession MIMAT0003624
Sequence

56 - 

cugugcgugugacagcggcuaa

 - 77

Get sequence
Evidence by similarity; MI0001379
Predicted targets