Stem-loop sequence xtr-mir-181a-1

AccessionMI0004865 (change log)
DescriptionXenopus tropicalis miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --   --ua  u     a   u      cu       a     g au 
5'   ggc    cu uagug aca ucaacg  gucggug guuug u  c
     |||    || ||||| ||| ||||||  ||||||| ||||| |  u
3'   ccg    gg auuac ugu aguugc  uagcuac caaac g  a
   ga   uaac  c     a   c      --       -     g aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 101423843-101423932 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181a-1
xtr-mir-181a-1chr4: 101423843-101423932 [-]
xtr-mir-181b-1chr4: 101423391-101423473 [-]
Database links

Mature sequence xtr-miR-181a-5p

Accession MIMAT0003625
Previous IDsxtr-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-181a-1-3p

Accession MIMAT0003626
Previous IDsxtr-miR-181a*;xtr-miR-181a-1*
Sequence

54 - 

accaucgaucguugacuguaca

 - 75

Get sequence
Evidence by similarity; MI0000289
Predicted targets

References

1