Stem-loop sequence xtr-mir-181a-2

AccessionMI0004866
DescriptionXenopus tropicalis miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uu           a a   u      cu       a     agaaagu 
5'   gagggcuucag g aca ucaacg  gucggug guuug       g
     ||||||||||| | ||| ||||||  ||||||| |||||        
3'   uuuucggaguc c ugu aguugc  cggcuac caaau       u
   ac           c a   c      --       -     auaaaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173569.1: 125246-125340 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181a-2
xtr-mir-181a-2GL173569.1: 125246-125340 [+]
xtr-mir-181b-2GL173569.1: 129413-129495 [+]

Mature sequence xtr-miR-181a-5p

Accession MIMAT0003625
Previous IDsxtr-miR-181a
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-181a-2-3p

Accession MIMAT0005461
Previous IDsxtr-miR-181a-2*
Sequence

61 - 

accaucggccguugacuguacc

 - 82

Get sequence
Evidence by similarity; MI0000289

References

1