Stem-loop sequence xtr-mir-181a-2

AccessionMI0004866 (change log)
DescriptionXenopus tropicalis miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   uu           a a   u      cu       a     agaaagu 
5'   gagggcuucag g aca ucaacg  gucggug guuug       g
     ||||||||||| | ||| ||||||  ||||||| |||||        
3'   uuuucggaguc c ugu aguugc  cggcuac caaau       u
   ac           c a   c      --       -     auaaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460364.1: 1377155-1377249 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-181a-2
xtr-mir-181a-2KV460364.1: 1377155-1377249 [+]
xtr-mir-181b-2KV460364.1: 1381322-1381404 [+]
Database links

Mature sequence xtr-miR-181a-5p

Accession MIMAT0003625
Previous IDsxtr-miR-181a
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-181a-2-3p

Accession MIMAT0005461
Previous IDsxtr-miR-181a-2*
Sequence

61 - 

accaucggccguugacuguacc

 - 82

Get sequence
Evidence by similarity; MI0000289
Predicted targets

References

1