Stem-loop sequence xtr-mir-214

AccessionMI0004867
DescriptionXenopus tropicalis miR-214 stem-loop
Gene family MIPF0000062; mir-214
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-214 is a vertebrate-specific family of microRNA precursors. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uu      aagga           u          aca            aacau 
5'   ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'   ccgacc     caacaguacac gacggacaga   ggacgacauguc     u
   -u      -----           u          cac            cacuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172721.1: 1804189-1804295 [-]
antisense
ENSXETT00000001173 ; dnm3-201; intron 18
Clustered miRNAs
< 10kb from xtr-mir-214
xtr-mir-199aGL172721.1: 1809312-1809407 [-]
xtr-mir-214GL172721.1: 1804189-1804295 [-]

Mature sequence xtr-miR-214

Accession MIMAT0003627
Sequence

68 - 

acagcaggcacagacaggcag

 - 88

Get sequence
Evidence by similarity; MI0000954
Predicted targets