Stem-loop sequence xtr-mir-214

AccessionMI0004867 (change log)
DescriptionXenopus tropicalis miR-214 stem-loop
Gene family MIPF0000062; mir-214
Stem-loop
   uu      aagga           u          aca            aacau 
5'   ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'   ccgacc     caacaguacac gacggacaga   ggacgacauguc     u
   -u      -----           u          cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 97346601-97346707 [+]
antisense
ENSXETT00000001173 ; dnm3-201; intron 18
Clustered miRNAs
< 10kb from xtr-mir-214
xtr-mir-199achr4: 97341496-97341591 [+]
xtr-mir-214chr4: 97346601-97346707 [+]
Database links

Mature sequence xtr-miR-214

Accession MIMAT0003627
Sequence

68 - 

acagcaggcacagacaggcag

 - 88

Get sequence
Evidence by similarity; MI0000954
Predicted targets