Stem-loop sequence xtr-mir-215

AccessionMI0004868
DescriptionXenopus tropicalis miR-215 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --   -u     c     gga  a     -          c  cuucca 
5'   aac  gguaa cagga   ug ccuau gaaaugacag ca      u
     |||  ||||| |||||   || ||||| |||||||||| ||      a
3'   uug  ucguu gucuu   ac ggaug cuuuacuguc gu      c
   ag   uu     a     aua  c     u          u  acaaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172818.1: 576168-576264 [+]
antisense
ENSXETT00000064574 ; iars2-202; intron 12
ENSXETT00000005915 ; iars2-201; intron 12
Clustered miRNAs
< 10kb from xtr-mir-215
xtr-mir-194-1GL172818.1: 575333-575412 [+]
xtr-mir-215GL172818.1: 576168-576264 [+]

Mature sequence xtr-miR-215

Accession MIMAT0003628
Sequence

18 - 

augaccuaugaaaugacagcc

 - 38

Get sequence
Evidence by similarity; MI0001371
Predicted targets