Stem-loop sequence xtr-mir-216

AccessionMI0004869 (change log)
DescriptionXenopus tropicalis miR-216 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ug      aa    cu         cu   a        -c    a 
5'   gcugug  uugg  uaaucucag  ggc acugugag  aguu a
     ||||||  ||||  |||||||||  ||| ||||||||  ||||  
3'   cgacac  aauc  auuaggguc  cug ugacacuc  uuaa u
   aa      -a    au         -u   g        ua    a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 26049025-26049115 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-216
xtr-mir-216chr5: 26049025-26049115 [-]
xtr-mir-217chr5: 26048662-26048744 [-]
Database links

Mature sequence xtr-miR-216

Accession MIMAT0003629
Sequence

17 - 

uaaucucagcuggcaacugug

 - 37

Get sequence
Evidence by similarity; MI0001382
Predicted targets