Stem-loop sequence xtr-mir-216

AccessionMI0004869
DescriptionXenopus tropicalis miR-216 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ug      aa    cu         cu   a        -c    a 
5'   gcugug  uugg  uaaucucag  ggc acugugag  aguu a
     ||||||  ||||  |||||||||  ||| ||||||||  ||||  
3'   cgacac  aauc  auuaggguc  cug ugacacuc  uuaa u
   aa      -a    au         -u   g        ua    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172878.1: 1208446-1208536 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-216
xtr-mir-216GL172878.1: 1208446-1208536 [+]
xtr-mir-217GL172878.1: 1208817-1208899 [+]

Mature sequence xtr-miR-216

Accession MIMAT0003629
Sequence

17 - 

uaaucucagcuggcaacugug

 - 37

Get sequence
Evidence by similarity; MI0001382
Predicted targets