Stem-loop sequence xtr-mir-217

AccessionMI0004870 (change log)
DescriptionXenopus tropicalis miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   uu       u  a  c     c          u  ---a     
5'   gauguug ag ua ugcau aggaacugau gg    uccc 
     ||||||| || || ||||| |||||||||| ||    ||| a
3'   cuacggc uc gu acgua uccuugacua cc    aggg 
   au       u  c  c     a          -  gacg     
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 26048662-26048744 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-217
xtr-mir-216chr5: 26049025-26049115 [-]
xtr-mir-217chr5: 26048662-26048744 [-]
Database links

Mature sequence xtr-miR-217

Accession MIMAT0003630
Sequence

14 - 

uacugcaucaggaacugauuggau

 - 37

Get sequence
Evidence by similarity; MI0001383
Predicted targets