Stem-loop sequence xtr-mir-218-1

AccessionMI0004871 (change log)
DescriptionXenopus tropicalis miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   ug   ac   --   a   u      u         cu        gguugugag 
5'   gua  aag  gcg gau uucugu gugcuugau  aaccaugu         g
     |||  |||  ||| ||| |||||| |||||||||  ||||||||          
3'   cau  uuc  cgc cug aaggua cacgaacug  uugguaca         u
   -a   cu   ga   a   c      c         uc        aaaugagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 22730596-22730704 [-]
sense
ENSXETT00000044254 ; slit2-201; intron 11
Database links

Mature sequence xtr-miR-218

Accession MIMAT0003631
Sequence

24 - 

uugugcuugaucuaaccaugu

 - 44

Get sequence
Evidence by similarity; MI0002052
Predicted targets