Stem-loop sequence xtr-mir-218-2

AccessionMI0004872
DescriptionXenopus tropicalis miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gg        uuu         cu        ------g   ga 
5'   gguuuucc   gugcuugau  aaccaugu       gua  a
     ||||||||   |||||||||  ||||||||       |||   
3'   ccggaagg   cacgaacug  uugguaca       cau  c
   ca        uac         uc        aguuaua   aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172974.1: 287357-287440 [-]
sense
ENSXETT00000029943 ; slit3-201; intron 13

Mature sequence xtr-miR-218

Accession MIMAT0003631
Sequence

12 - 

uugugcuugaucuaaccaugu

 - 32

Get sequence
Evidence by similarity; MI0002052
Predicted targets