Stem-loop sequence xtr-mir-218-2

AccessionMI0004872 (change log)
DescriptionXenopus tropicalis miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   gg        uuu         cu        ------g   ga 
5'   gguuuucc   gugcuugau  aaccaugu       gua  a
     ||||||||   |||||||||  ||||||||       |||   
3'   ccggaagg   cacgaacug  uugguaca       cau  c
   ca        uac         uc        aguuaua   aa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 24052813-24052896 [+]
sense
ENSXETT00000029943 ; slit3-201; intron 13
Database links

Mature sequence xtr-miR-218

Accession MIMAT0003631
Sequence

12 - 

uugugcuugaucuaaccaugu

 - 32

Get sequence
Evidence by similarity; MI0002052
Predicted targets