Stem-loop sequence xtr-mir-222

AccessionMI0004874
DescriptionXenopus tropicalis miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   ----c        au   -     auc   uau 
5'      gcucagua  cag uguag   cug   a
        ||||||||  ||| |||||   |||   u
3'      ugggucau  guc acauc   gac   c
   aucuc        cg   u     gac   ugu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172805.1: 2026404-2026467 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-222
xtr-mir-222GL172805.1: 2026404-2026467 [+]
xtr-mir-221GL172805.1: 2026912-2027004 [+]

Mature sequence xtr-miR-222

Accession MIMAT0003633
Sequence

39 - 

agcuacaucuggcuacugggucuc

 - 62

Get sequence
Evidence by similarity; MI0001388
Predicted targets