Stem-loop sequence xtr-mir-223

AccessionMI0004875 (change log)
DescriptionXenopus tropicalis miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   a    gg    ga u              gagucc       aau 
5'  gugu  cacu  g guauuugacaagcu      gacacuc   g
    ||||  ||||  | ||||||||||||||      |||||||   a
3'  cacg  guga  c cauaaacuguuuga      cugugag   g
   -    ga    ac c              ------       aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 19321710-19321795 [-]
intergenic
Database links

Mature sequence xtr-miR-223

Accession MIMAT0003634
Sequence

55 - 

ugucaguuugucaaauacccc

 - 75

Get sequence
Evidence by similarity; MI0000963
Predicted targets