Stem-loop sequence xtr-mir-301-1

AccessionMI0004876 (change log)
DescriptionXenopus tropicalis miR-301-1 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
        aa   --     c    ---u          ----a       
5' cugcu  ugu  gugcu ugac    uuauugcacu     cuguac 
   |||||  |||  ||||| ||||    ||||||||||     ||||| u
3' gacga  acg  uacga acug    gauaacguga     gacaua 
        --   uc     a    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 91417649-91417732 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-301-1
xtr-mir-130achr2: 91417440-91417522 [+]
xtr-mir-301-1chr2: 91417649-91417732 [+]
Database links

Mature sequence xtr-miR-301

Accession MIMAT0003635
Sequence

50 - 

cagugcaauaguauugucaaagc

 - 72

Get sequence
Evidence by similarity; MI0002062
Predicted targets